Type error when counting variants (Overlap SeqLib) : `TypeError: 'str' object does not support item assignment`

[ppreshant]

I'm running enrich2 on paired end reads from a small run of amplicon-EZ with the alignment option turned off. This is the error I see and is very unintuitive where it is coming from. Here's my command for the CLI run: pixi run enrich_cmd della_pairedEnd.json ratios complete

Tried

I tried these things but doesn't affect the error message at all

• use aligner : true
• turn off trim within overlap and report filtered reads" by setting to false
• Changing the normalization to wt and full instead.

Setup method

I have a feeling this could be a python version issue but here's how I made my pixi environment

• Copied the dependancies from the enrich2_env.yml on github.
• I did a pixi install using this toml
• Here's the final pixi.toml after installing enrich2 from pypi.

[workspace]
authors = ["Prashant Kalvapalle <ppresh.ant@gmail.com>"]
channels = ["conda-forge", "bioconda"]
name = "enrich2_library"
platforms = ["linux-64"]
version = "0.1.0"

[tasks]

[dependencies]
python = "3.*"
numpy = "*"
scipy = "*"
pandas = "*"
pytables = "*"
statsmodels = "*"
matplotlib = "*"
fastp = ">=1.3.6,<2"
cutadapt = ">=5.2,<6"

[pypi-dependencies]
enrich2 = ">=2.0.2, <3"

Error message

pixi run enrich_cmd della_pairedEnd.json ratios complete
2026-08-26 18:50:17,840 [enrich2.main] Detected an Experiment config file
2026-08-26 18:50:17,841 [enrich2.experiment.Experiment - DELLA_low_depth] Creating new HDF5 data store "results/DELLA_low_depth_exp.h5"
2026-08-26 18:50:19,433 [enrich2.selection.Selection - Input] Creating new HDF5 data store "results/Input_sel.h5"
2026-08-26 18:50:19,439 [enrich2.overlap.OverlapSeqLib - Input_before_enrichment] Creating new HDF5 data store "results/Input_before_enrichment_lib.h5"
2026-08-26 18:50:19,445 [enrich2.overlap.OverlapSeqLib - Enriched] Creating new HDF5 data store "results/Enriched_lib.h5"
2026-08-26 18:50:19,451 [enrich2.selection.Selection - Input] Counting for each time point (variants)
2026-08-26 18:50:19,469 [enrich2.overlap.OverlapSeqLib - Input_before_enrichment] Counting variants
Traceback (most recent call last):
  File "/home/prashantk/bioinformatics/enrich2_library/.pixi/envs/default/bin/enrich_cmd", line 10, in <module>
    sys.exit(main_cmd())
             ^^^^^^^^^^
  File "/home/prashantk/bioinformatics/enrich2_library/.pixi/envs/default/lib/python3.12/site-packages/enrich2/main.py", line 225, in main_cmd
    obj.calculate()
  File "/home/prashantk/bioinformatics/enrich2_library/.pixi/envs/default/lib/python3.12/site-packages/enrich2/experiment.py", line 156, in calculate
    s.calculate()
  File "/home/prashantk/bioinformatics/enrich2_library/.pixi/envs/default/lib/python3.12/site-packages/enrich2/selection.py", line 425, in calculate
    self.merge_counts_unfiltered(label)
  File "/home/prashantk/bioinformatics/enrich2_library/.pixi/envs/default/lib/python3.12/site-packages/enrich2/selection.py", line 295, in merge_counts_unfiltered
    lib.calculate()
  File "/home/prashantk/bioinformatics/enrich2_library/.pixi/envs/default/lib/python3.12/site-packages/enrich2/overlap.py", line 326, in calculate
    self.counts_from_reads()
  File "/home/prashantk/bioinformatics/enrich2_library/.pixi/envs/default/lib/python3.12/site-packages/enrich2/overlap.py", line 277, in counts_from_reads
    merge = self.merge_reads(fwd, rev)
            ^^^^^^^^^^^^^^^^^^^^^^^^^^
  File "/home/prashantk/bioinformatics/enrich2_library/.pixi/envs/default/lib/python3.12/site-packages/enrich2/overlap.py", line 214, in merge_reads
    merge.sequence[a] = "X"  # unresolvable
    ~~~~~~~~~~~~~~^^^
TypeError: 'str' object does not support item assignment
/home/prashantk/bioinformatics/enrich2_library/.pixi/envs/default/lib/python3.12/site-packages/tables/file.py:130: UnclosedFileWarning: Closing remaining open file: results/Input_sel.h5
  warnings.warn(UnclosedFileWarning(msg))
/home/prashantk/bioinformatics/enrich2_library/.pixi/envs/default/lib/python3.12/site-packages/tables/file.py:130: UnclosedFileWarning: Closing remaining open file: results/DELLA_low_depth_exp.h5
  warnings.warn(UnclosedFileWarning(msg))
/home/prashantk/bioinformatics/enrich2_library/.pixi/envs/default/lib/python3.12/site-packages/tables/file.py:130: UnclosedFileWarning: Closing remaining open file: results/Enriched_lib.h5
  warnings.warn(UnclosedFileWarning(msg))
/home/prashantk/bioinformatics/enrich2_library/.pixi/envs/default/lib/python3.12/site-packages/tables/file.py:130: UnclosedFileWarning: Closing remaining open file: results/Input_before_enrichment_lib.h5

Here's the json file if it is helpful

{
  "name": "DELLA_low_depth",
  "output directory": "results/",

  "conditions": [
    {
      "name": "All",

      "selections": [
        {
          "name": "Input",

          "libraries": [
            {
              "name": "Input_before_enrichment",
              "timepoint": 0,
              "report filtered reads": true,

              "overlap": {
                "forward start": 1,
                "length": 290,
                "max mismatches": 100,
                "reverse start": 1,
                "trim": true
              },


              "fastq": {
                "forward reads": "fastq/GS2431UQ5AF_R1_001.fastq.gz", 
                "reverse reads": "fastq/GS2431UQ5AF_R2_001.fastq.gz",

                "filters": {
                  "min quality": 20
                }
              },

              "variants": {
                "min count": 0,
                "use aligner": false,
                "wild type": {
                  "sequence": "GTTAAAAAAGAGGAAGACGGCGGGGGTAATATGGATGATGAATTGCTGGCCGTGTTGGGTTACAAAGTTAGATCAAGTGAGATGGCCGAAGTGGCACTTAAGCTTGAACAACTGGAAACTATGATGAGCAACGTCCAGGAAGATGGTCTTTCCCACTTAGCGACGGACACTGTGCATTACAACCCTTCTGAGTTATACAGTTGGCTAGACAACATGCTTAGCGAGCTGAATCCCCCGC",
                  "coding": false,
                  "reference offset": 0
                }
              }
            },

            {
              "name": "Enriched",
              "timepoint": 2,
              "report filtered reads": true,

              "overlap": {
                "forward start": 1,
                "length": 290,
                "max mismatches": 100,
                "reverse start": 1,
                "trim": true
              },

              "fastq": {
                "forward reads": "fastq/GS2436UQ5AF_R1_001.fastq.gz",
                "reverse reads": "fastq/GS2436UQ5AF_R2_001.fastq.gz",

                "filters": {
                  "min quality": 20
                }
              },

              "variants": {
                "min count": 0,
                "use aligner": false,
                "wild type": {
                  "sequence": "GTTAAAAAAGAGGAAGACGGCGGGGGTAATATGGATGATGAATTGCTGGCCGTGTTGGGTTACAAAGTTAGATCAAGTGAGATGGCCGAAGTGGCACTTAAGCTTGAACAACTGGAAACTATGATGAGCAACGTCCAGGAAGATGGTCTTTCCCACTTAGCGACGGACACTGTGCATTACAACCCTTCTGAGTTATACAGTTGGCTAGACAACATGCTTAGCGAGCTGAATCCCCCGC",
                  "coding": false,
                  "reference offset": 0
                }
              }
            }

            
          ]
        }
      ]
    }
  ]
}