Error parsing SAM file `MAPQ must be zero if RNAME is not specified`

[LouisLeNezet]

Hi,

When creating the nf-test for graphmap2/align command I ran into the following error when trying to extract the read of the generated SAM file:
htsjdk.samtools.SAMFormatException: Error parsing text SAM file. MAPQ must be zero if RNAME is not specified

The command use was

wget https://raw.githubusercontent.com/nf-core/test-datasets/modules/data/genomics/sarscov2/genome/genome.fasta
graphmap2 align -I -r genome.fasta

wget https://raw.githubusercontent.com/nf-core/test-datasets/modules/data/genomics/sarscov2/nanopore/fastq/test.fastq.gz
graphmap2 align \\
        -r genome.fasta \\
        -i genome.fasta.gmidx \\
        -d test.fastq.gz \\
        -o test.sam

And here is the first read after alignment

@HD	VN:1.0	SO:unknown
@SQ	SN:MT192765.1	LN:29829
@PG	ID:graphmap	PN:graphmap	CL:graphmap2 -t 2 -r genome.fasta -i genome.fasta.gmidx -d test.fastq.gz -o test.sam	VN:v0.6.3 compiled on Nov 15 2019 at 19:39:45
00068f7a-51b3-4933-8fc6-7d6e29181ff9	4	*	0	255	*	*	0	0	TTGTGCTTCGTTTCAGTTACCGTATTGCTAGGTTAACACAAAGACACCGACAACTTTCTTCAGCACCTACAAACTGCCACCATGCAACCCAAAAAACCATGTAATGCCTATTGTCCAGTTCTTTCTACTCCCTTTGCCCTAGGGGACCTTAGGTACTGCTCTTTTCTACCTTCCCTATACCTCTCCCATTCCACCACCATTTCTTTTCTTCAGGACTCAACATGGCAAAGGAAGACCTAGGTGCTGAAGAAGTTGTCGGTGTCTTTGTGTTAACCTTAGCAATACGTAACA	/4,(###)#'%:/(%,%($$$#&%%(&1/3*0**98;7@FFA:?E>7/,00./<=AA<;;691(/89=579:174/*+&&/42,9-0-76@A=42'-**---99:)23736:<=998<=>7=:1+($3789=8:8559;3:19?==98<=199997:6696?AC@6:9?=EH>@<-=847341.-.489A==431,0($%')'())/''*$%94302;46====6596',14--96753670.(-.0-&)',-.'*,&&&$.+./+(5,13/+)*)2+))/(102+*))&'	NM:i:-1	AS:i:-291	H0:i:0	ZE:f:3.40282e+38	ZF:f:0	ZQ:i:291	ZR:i:0

From what I understood the MAPQ should not be set to 255 but to 0, is it normal ?