Skip to content

Latest commit

 

History

13 Commits

Folders and files

NameName
Last commit message
Last commit date
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

Repository files navigation

Bloom-Enhanced DNABERT for Sickle Cell Variant Classification

A plugin-oriented framework for biosequence foundation models: combine pattern indexes (e.g. multi-scale Bloom filters) with transformer backbones (reference: DNABERT-2) using the novel Bloom-Guided Positional Cross-Attention (BGPCA) stack for position-aware fusion and uncertainty estimation. Third-party wheels can register new backbones, alphabets, indexes, and data sources via Python entry points—see PLUGINS.md and the model ideas catalog in MODELS.md.

This repository is a research and education codebase, not a medical device. Outputs are not validated for clinical diagnosis or treatment. See Disclaimer below.

Documentation map: This README is the main manual. DATASETS.md covers ClinVar sources, file formats, and build scripts. CONTRIBUTING.md describes development setup, tests, and root-level smoke scripts. QUICKSTART.md and PROJECT_FILES_GUIDE.md provide shorter orientation. Plugin development: PLUGINS.md, MODELS.md.

Key Features

  • BGPCA Architecture (Novel): Cross-attention where Bloom filter signals serve as attention biases
  • Multi-scale Bloom Filters: Fast O(1) lookup of known pathogenic k-mers at k=6, 8, 10
  • DNABERT-2 Integration: 117M parameter transformer for deep sequence understanding
  • Position-Aware Fusion: Preserves spatial correspondence between Bloom hits and DNABERT tokens
  • Uncertainty Estimation: Monte Carlo dropout for epistemic uncertainty quantification
  • Mutation-Aware Pooling: Bloom-guided position importance weighting
  • Gated Cross-Modal Fusion: Dynamically balances pattern matching vs contextual understanding
  • Interpretable Visualizations: Attention heatmaps, position importance, gate values
  • Early Stopping + Best Checkpoint: Automatic training halt with model restoration
  • K-Fold Cross-Validation: Reliable performance estimates for small datasets
  • Class-Weighted Loss: Handles imbalanced pathogenic/benign ratios
  • Calibration Analysis: ECE/MCE metrics to verify prediction reliability
  • ClinVar integration: HBB-focused live API, curated CSVs, or optional large pan-gene GRCh38 SNV windows from scripts/build_clinvar_pan_dataset.py (see DATASETS.md). Training does not fall back to synthetic data unless you explicitly opt in (allow_synthetic=True or BLOOM_DNABERT_ALLOW_SYNTHETIC=1) for tests or experiments.
  • Interactive web dashboard: Gradio UI for training and sequence analysis

Novel Contribution: BGPCA Architecture

The Problem

Existing hybrid approaches for DNA variant classification simply concatenate features from different sources (e.g., Bloom filter statistics + DNABERT embeddings), which causes:

  1. Positional information loss: Bloom filters know exactly where pathogenic k-mer hits occur, but this is crushed into 18 scalar summary statistics
  2. No cross-modal interaction: Bloom signals never influence what the transformer attends to
  3. Naive fusion: The MLP must learn all modality interactions from scratch
  4. No uncertainty: No way to express "I'm not confident about this prediction"

The Solution: Bloom-Guided Positional Cross-Attention

BGPCA preserves per-position Bloom filter signals and uses them as additive attention biases in a cross-attention mechanism with DNABERT's per-token hidden states.

Standard cross-attention:

Attn(Q, K, V) = softmax(QK^T / sqrt(d)) V

Bloom-guided cross-attention (novel):

Attn(Q, K, V; B) = softmax(QK^T / sqrt(d) + phi(B)) V

where phi(B) is a learned projection of Bloom positional encodings that creates per-head, per-position attention biases. Positions with strong Bloom activation receive higher bias, naturally drawing the model's attention to potential mutation sites.

Architecture Diagram

DNA Sequence
      |
      +---> [Bloom Filter (k=6,8,10)]
      |           |                    |
      |      Per-position signal   Summary features
      |   [seq_len, n_scales]    [feature_dim]
      |           |                    |
      |    [PositionalBloomEncoder]    |
      |      (multi-scale 1D CNN)      |
      |      [seq_len, d_bloom]         |
      |           |                    |
      +---> [Backbone encoder]         |
                  |                    |
           Per-token hidden            |
        [seq_len, d_model]             |
                  |                    |
      [BloomGuidedCrossAttention]      |
        Q = backbone tokens            |
        K = Bloom encodings            |
        V = backbone tokens            |
        Bias = Bloom activation        |
              x N layers               |
                  |                    |
       [MutationAwarePooling]          |
         (Bloom-weighted attention     |
          over positions)              |
                  |                    |
              [d_model]                |
                  |                    |
       [GatedCrossModalFusion] <-------+
         g * cross_attn + (1-g) * bloom_proj
                  |
           [Classification Head]
                  |
         (logit, uncertainty)

Why This Is Novel

Aspect Prior Work BGPCA
Bloom filter role Feature extractor (flat vector) Attention bias generator (positional)
Spatial information Lost in summarization Preserved per-position
Cross-modal interaction None (independent streams) Cross-attention with Bloom bias
Fusion strategy Concatenation Learned gating
Backbone features Pooled embedding Per-token hidden states
Uncertainty Not available Monte Carlo dropout
Interpretability Basic attention maps Position importance + gate values

Comparison: Baseline vs BGPCA

Component Baseline BGPCA
Bloom features Summary vector (index feature_dim) Per-position activation signal
Backbone features Mean-pooled hidden states Per-token hidden states
Fusion cat(bloom, backbone) → MLP Cross-attention + gated fusion
Architecture 2-layer MLP on concatenated features Bloom encoder + 2× cross-attn + pooling + gate + classifier
Position awareness None Full positional correspondence
Uncertainty No MC Dropout (20 samples)
Interpretability Attention heatmap Position importance, cross-attn weights, gate values

Architecture overview (code map)

Concern Module Role
Core protocols + registry bloom_seq/protocols.py, bloom_seq/registry.py Typed contracts; importlib.metadata entry points (bloom_seq.*)
Multi-scale Bloom filter + k-mer hits bloom_seq/plugins/multiscale_bloom/index.py O(1) pathogenic k-mer checks; positional signal for BGPCA
DNABERT-2 encode + hidden states bloom_seq/plugins/dnabert2/wrapper.py, bloom_seq/plugins/dnabert2/backbone.py Transformer embeddings; supports offline cache env vars
Baseline hybrid MLP bloom_seq/pipeline.py (HybridClassifierPipeline) Concat(Bloom summary, pooled backbone embedding) → MLP
BGPCA stack bloom_seq/bridge.py, bloom_seq/pipeline.py (BloomGuidedPipeline) Cross-attention with Bloom bias, gated fusion, MC dropout
Training data bloom_seq/plugins/clinvar_hbb/source.py (ClinVarDataLoader, DataSourceError) CSV / API resolution; stratified splits without sequence leakage
Sequence priors / plausibility bloom_seq/plugins/plausibility_dna_trinuc/prior.py Trinucleotide context helpers (bundled JSON in plugin)
Web UI app.py Gradio dashboard
Legacy imports bloom_dnabert/init.py Deprecation shim re-exporting bloom_seq

Bloom filters are seeded from known HBB pathogenic k-mers for this project’s scope; using the same seeds on pan-gene CSV training is a documented design choice (see DATASETS.md).

Data sources and resolution order

The loader resolves variants in this order (under default cache_dir= data/):

Priority File / source Notes
1 data/clinvar_pan_grch38_snvs.csv Built with scripts/build_clinvar_pan_dataset.py + GRCh38 FASTA (large; ignored by git by default).
2 data/hbb_clinvar_refined.csv Small HBB exonic SNV slice; build with scripts/build_hbb_clinvar_dataset.py (requires network).
3 data/hbb_variants.csv Cached ClinVar API pull; valid if version >= 4.
4 Live NCBI ClinVar (eutils) Fetched when no usable CSV exists; subject to rate limits.

If none of the above produce rows and synthetic mode is off, ClinVarDataLoader.fetch_hbb_variants() raises DataSourceError with paths and pointers to DATASETS.md.

First-time setup for training: run python scripts/build_hbb_clinvar_dataset.py (or place a compatible CSV). The pan-genome table is optional and needs a local reference FASTA; see DATASETS.md.

Quick start

1. Install

Option A — editable install (recommended for contributors):

python -m venv .venv
source .venv/bin/activate   # Windows: .venv\Scripts\activate
pip install -e ".[dl,ui,dev]"

Core-only install (no PyTorch / Gradio; registry + protocol tests only):

pip install -e "."

Option B — requirements file only:

pip install -r requirements.txt
pip install pytest pytest-cov   # optional, for running tests

Python 3.10+ is supported (CI exercises 3.11 and 3.12).

2. Hugging Face cache and optional HF_HOME

Model weights for zhihan1996/DNABERT-2-117M download into the Hugging Face cache. You do not need to set HF_HOME unless you want a custom location (e.g. a larger disk). Example:

export HF_HOME="$HOME/.cache/huggingface"

For air-gapped use, pre-populate the cache and set HF_HUB_OFFLINE=1 as described in bloom_seq/plugins/dnabert2/wrapper.py.

3. Launch the web dashboard

python app.py

The UI is served at http://127.0.0.1:7860 by default. Equivalent entry point: python launch_dashboard.py (UTF-8 console tweaks on Windows only).

Inference loads Bloom + DNABERT without training data. Training inside the app requires real variant rows per the data table above; otherwise the loader raises DataSourceError.

4. Using the dashboard

  1. Train the model (requires data): open the Train Model tab, choose BGPCA or Baseline, set epochs, click Train Model.
  2. Analyze sequences: open Analyze Sequence, paste ATCG sequence (length limits enforced in code), run analysis, inspect probability, uncertainty, attention, and Bloom hits.

5. Triton compatibility (DNABERT-2)

Upstream DNABERT-2 may import Flash attention paths that expect Triton. This repo ships bloom_seq/plugins/dnabert2/triton_compat.py and create_triton_stub.py so CPU / non-Triton PyTorch can run the model safely. You normally do not need to run the script unless your environment still pulls incompatible Flash kernels; see comments in wrapper.py.

A shorter checklist lives in QUICKSTART.md.

Architecture Components

1. Positional Bloom Encoder

Multi-scale 1D convolutions (kernels: 3, 5, 7) encode raw per-position Bloom filter activation signals into dense embeddings, capturing local hit patterns like mutation hotspots vs isolated false positives.

2. Bloom-Guided Cross-Attention

The core innovation. Cross-attention where:

  • Q (queries) come from DNABERT token representations
  • K (keys) come from Bloom positional encodings
  • V (values) come from DNABERT token representations
  • Bias comes from Bloom activation magnitude (structural prior)

The Bloom bias acts as a "spotlight" that tells the attention mechanism: "pay extra attention to these positions -- the Bloom filter detected known pathogenic patterns here."

3. Mutation-Aware Pooling

Instead of mean pooling (treats all positions equally), learns position-wise importance weights guided by Bloom activation. Positions overlapping pathogenic k-mer hits naturally receive higher weight.

4. Gated Cross-Modal Fusion

A sigmoid gate that dynamically balances:

  • Cross-attention path (rich contextual understanding from DNABERT + Bloom spatial information)
  • Bloom summary path (direct pattern matching features)

When Bloom has strong signal, the gate trusts pattern matching. When weak, it relies on DNABERT's generalization.

5. Monte Carlo Dropout Uncertainty

Multiple stochastic forward passes with dropout enabled estimate epistemic uncertainty. High uncertainty indicates the model is unsure -- critical for clinical applications.

Training Robustness

Both architectures include production-grade training features:

  • Early stopping with configurable patience (default 10 epochs), tracking validation loss with automatic best-model checkpoint restoration
  • Gradient clipping (max norm 1.0) prevents gradient explosions
  • Class-weighted BCE loss automatically compensates for imbalanced pathogenic/benign ratios
  • CosineAnnealing LR scheduler with warm restarts for smooth convergence
  • K-fold cross-validation (pipeline.cross_validate(seqs, labels, n_folds=5)) for reliable small-dataset evaluation
  • Calibration analysis (pipeline.calibration_analysis(seqs, labels)) computes ECE/MCE to verify predicted probabilities match observed frequencies
  • Input validation enforces 10-5000 bp length, DNA/RNA alphabet (including ambiguity symbols when configured), and sanitizes all inputs before inference

Python API

Novel BGPCA Architecture

from bloom_seq.plugins.multiscale_bloom import MultiScaleBloomFilter
from bloom_seq.plugins.dnabert2.wrapper import DNABERTWrapper
from bloom_seq.pipeline import BloomGuidedPipeline

# Initialize
bloom_filter = MultiScaleBloomFilter()
bloom_filter.load_hbb_pathogenic_variants()
dnabert = DNABERTWrapper()

# Create BGPCA pipeline
pipeline = BloomGuidedPipeline(bloom_filter, dnabert)

# Train
pipeline.train(train_sequences, train_labels, epochs=50)

# Predict with uncertainty
result = pipeline.predict_with_uncertainty("CACGTGGTCTACCCCTGAGGAG...")
print(f"Prediction: {result['prediction']}")
print(f"Probability: {result['probability']:.3f}")
print(f"Uncertainty: {result['uncertainty']:.4f} ({result['uncertainty_level']})")

# Predict with full interpretability
interp = pipeline.predict_with_interpretability("CACGTGGTCTACCCCTGAGGAG...")
print(f"Position importance shape: {interp['position_importance'].shape}")
print(f"Gate values (Bloom vs DNABERT): {interp['gate_values'].mean():.3f}")

Baseline Architecture

from bloom_seq.pipeline import HybridClassifierPipeline

pipeline = HybridClassifierPipeline(bloom_filter, dnabert)
pipeline.train(train_sequences, train_labels, epochs=50)
result = pipeline.predict("CACGTGGTCTACCCCTGAGGAG...")

K-Fold Cross-Validation

# More reliable metrics for small datasets
results = pipeline.cross_validate(all_sequences, all_labels, n_folds=5, epochs=30)
print(f"Accuracy: {results['accuracy_mean']:.3f} +/- {results['accuracy_std']:.3f}")
print(f"AUC-ROC: {results['auc_roc_mean']:.3f} +/- {results['auc_roc_std']:.3f}")

Calibration Analysis

# Verify prediction reliability
cal = pipeline.calibration_analysis(test_sequences, test_labels)
print(f"Expected Calibration Error: {cal['ece']:.4f}")
print(f"Maximum Calibration Error: {cal['mce']:.4f}")

Per-Position Bloom Signal

# Get per-position Bloom activation
signal = bloom_filter.get_positional_signal("CACGTGGTCTACCCCTGAGGAG")
# shape: [seq_len, 3] -- one channel per k-mer scale (k=6,8,10)

Project structure

BloomDNABert/
+-- app.py                         # Gradio web dashboard
+-- launch_dashboard.py            # Thin launcher (imports app.main)
+-- pyproject.toml                 # bloom-seq metadata, extras [dl]/[ui]/[dev], entry points
+-- requirements.txt               # Practical full stack (≈ pip install -e ".[dl,ui]")
+-- PLUGINS.md, MODELS.md          # Plugin how-to and model catalog (docs only)
+-- LICENSE                        # MIT
+-- README.md                      # This manual
+-- DATASETS.md                    # Data provenance and build commands
+-- CONTRIBUTING.md                # Dev setup, tests, smoke scripts
+-- CODE_OF_CONDUCT.md
+-- SECURITY.md
+-- .github/workflows/ci.yml       # minimal (core) + full (extras) pytest jobs
+-- bloom_seq/                     # Core framework + bundled reference plugins
|   +-- protocols.py, registry.py, errors.py, alphabets.py, splits.py
|   +-- bridge.py                  # BGPCA layers
|   +-- pipeline.py                # Baseline + BGPCA pipelines
|   +-- viz.py
|   +-- plugins/
|       +-- dnabert2/              # Backbone + Triton compat
|       +-- multiscale_bloom/      # Pattern index
|       +-- clinvar_hbb/           # Data source, seeds, clinvar_pan
|       +-- plausibility_dna_trinuc/
+-- bloom_dnabert/                 # Deprecation shim (re-exports bloom_seq)
|   +-- __init__.py
+-- scripts/
|   +-- build_hbb_clinvar_dataset.py
|   +-- build_clinvar_pan_dataset.py
+-- tests/                         # pytest collection (mocks heavy DL stack where needed)
+-- data/                          # Gitignored large files; see DATASETS.md
    +-- (optional) hbb_clinvar_refined.csv, hbb_variants.csv
    +-- (optional, large) clinvar_pan_grch38_snvs.csv, refs/hg38.fa, ...

Root-level test_system.py, test_train.py, and test_end_to_end.py are manual smoke scripts, not pytest tests (CONTRIBUTING.md).

Scientific Background

Sickle Cell Disease

  • Most common inherited blood disorder
  • Caused by HBB gene mutation (chr11:5227002 T>A)
  • Point mutation at codon 6: Glu -> Val
  • Results in abnormal hemoglobin (HbS)
  • Affects millions worldwide

Related Work

  • DNABERT-2: Zhou et al. (2023) -- transformer for DNA sequences
  • Bloom Filters in Bioinformatics: Solomon & Kingsford (2016) -- k-mer indexing
  • ALiBi: Press et al. (2022) -- learned attention biases (related concept)
  • Perceiver: Jaegle et al. (2021) -- cross-attention architecture (related concept)
  • MC Dropout: Gal & Ghahramani (2016) -- uncertainty estimation
  • ClinVar: Landrum et al. (2018) -- clinical variant database

Limitations

  • Training quality depends on real labels (ClinVar CSV/API or pan-genome table); synthetic data is not a default training source.
  • Not a clinical-grade or regulatory-validated system; independent validation would be required for any diagnostic use.
  • DNABERT-2 practical context length is limited by model max length (on the order of ~512–2048 tokens depending on tokenizer settings; see wrapper and model card).
  • Bloom filters have false positives (error rate configurable; dashboard uses a fixed capacity/error tradeoff in code).
  • BGPCA is heavier than the baseline (sequence-length-dependent attention cost).
  • Windows/macOS/Linux CPU paths rely on PyTorch attention implementations; GPU Triton kernels are environment-dependent.

Testing

Automated tests live under tests/ and mock Hugging Face / Gradio where appropriate so CI does not download multi-gigabyte weights.

pip install -e ".[dl,ui,dev]"
pytest tests/ -q

For full-stack manual checks with real weights and optional live data, see CONTRIBUTING.md (root smoke scripts).

Community

Future Work

  • Expand ClinVar integration to fetch full variant annotations and evidence levels
  • Add support for more genes (BRCA1, BRCA2, TP53)
  • Implement counting Bloom filters for frequency tracking
  • Add multi-variant analysis (compound heterozygotes)
  • Extend BGPCA to multi-class classification (pathogenic subtypes)
  • Clinical validation studies on independent datasets
  • Fairness analysis across population groups
  • Explore Bloom filter as attention bias in other domains (proteomics, drug discovery)

Citation

If you use this software, please cite the repository and the underlying DNABERT-2 model (see the model card). Replace maintainer names in author when you publish a paper or Zenodo archive.

@software{bloom_seq,
  title        = {Bloom Seq: Plugin Framework for Biosequence Models with Bloom--Transformer {BGPCA}},
  author       = {BloomDNABert contributors},
  year         = {2026},
  note         = {PyPI distribution name bloom-seq; legacy package bloom\_dnabert is deprecated.}
}

Disclaimer

This is a research prototype for educational and research purposes only. This system should NOT be used for clinical diagnosis or treatment decisions. Always consult with qualified healthcare professionals and genetic counselors for medical interpretation of genetic variants.


Built with: PyTorch, Transformers, Gradio, Plotly

About

A plugin-oriented framework for biosequence foundation models

Resources

Code of conduct

Contributing

Security policy

Stars

7 stars

Watchers

0 watching

Forks

Releases

Packages

Contributors

Languages