Skip to content

Repository files navigation

install with bioconda

TKSM

TKSM (Turkish: Taksim, Arabic: تقسيم, both meaning to divide) is a modular software for simulating long-read sequencing. Each module is meant to simulate a specific step in the sequencing process. The modules are designed to be piped together to form a pipeline which is specified in the configuration file. The pipelines are executed using Snakemake.

If you are interested in the paper results, please check out the paper branch.

Installation

Conda (only available for Linux at the moment.)

The easiest installation method is to use Conda or, much prefereblally, Mamba. If you are using Conda, replace mamba with conda in the following commands.

Run:

mamba install -c bioconda tksm

Source

To install from source, you need to have to fulfill the dependencies of TKSM. This can be done using Mamba (or Conda) by running:

mamba create -f env.yml
mamba activate tksm

You may also need to install all the packages listed in the env.yml file manually (not recommended).

Then, you can install TKSM by running:

INSTALL_PREFIX="<install_prefix>" make -j <threads>
./install.sh

Where <install_prefix> is the path to the directory where you want to install TKSM. For example, if you want to install TKSM in /usr/bin, you should run:

INSTALL_PREFIX="/usr" make -j <threads>
./install.sh

The install.sh script will copy the TKSM executable and some predefined models to the bin directory under the INSTALL_PREFIX directory.

Quick testing

Install TKSM from source and run the following commands to test the installation:

wget https://figshare.com/ndownloader/files/43059307 -O tksm-test-data.tar.gz
tar -zvxf tksm-test-data.tar.gz
snakemake --configfile config-test.yaml -j32

Running using Snakemake

Snakemake assumes that TKSM is installed in your $PATH and can be run by simply calling tksm. You can modify the exec parameter in the config.yaml file to specify the path to the TKSM executable.

The minimum version of Snakemake required is 6v. To specify a simulation pipeline, modify the config.yaml file.

TKSM documentation

TKSM has a number of of implemented modules. There are four types of modules: entry-point modules, core modules, utility modules, and the exit module.

  • Entry-point modules are the modules that are used to start a simulation pipeline. They generate files in the MDF format (see below).
  • Core modules are the modules that modify the molecules. They take MDF files as input and generate MDF files as output.
  • Utility modules are the modules generate models that are used by specific modules (e.g. TPM for isoforms that is used by the Transcriber module).
  • Exit module is the module that generates the final output of the simulation pipeline. It takes MDF files as input and generates FASTA/A files as output.

TKSM pipeline

Type Name Description
Utility Exprs Bulk or single-cell transcript abundance estimation
Utility Badread Build base-level quality and error models using Badread
Utility KDE Build truncation model
Entry Tsb Generate transcripts molecules from GTF and expression data
Entry Mrg Merge output of one or more pipelines into a single MDF
Core plA Add polyA tail to molecules
Core Trc Truncate the molecules
Core Tag Tag 5' or 3' end with specified FASTA pattern
Core Flt Filter on conditions; optionally output failed molecules
Core PCR PCR amplification
Core Glu Given a random chance, glue the molecule to its successor
Core SCB Cell barcode tagging (from tags added by Tsb module)
Core Flp Flip the strand of the molecules with a given probability
Core Shf Shuffle the molecules into a random order
Exit Seq Sequence molecules into reads using Badread

A TKSM pipeline is defined in the config.yaml file and can be composed of any number or combination of these modules.

Configuration

The config.yaml file is used to specify the pipeline modules and the parameters of each module. Check for the following example for a TKSM pipeline configuration:

TS_experiments:
    TKSM_bulk:
        pipeline:
            - Tsb:
                params: "--molecule-count 1000000"
                model: "MCF7-sgnex"
                mode: Xpr
            - Trc:
                params: ""
                model: "MCF7-sgnex"
            - plA:
                params: "--normal=15,7.5"
            - Flp:
                params: "-p 0.5"
            - Tag:
                params: "--format5 AATGTACTTCGTTCAGTTACGTATTGCT --format3 GCAATACGTAACTGAACGAAGT"
            - Seq:
                params: "--skip-qual-compute"
                model: "MCF7-sgnex"

This specifies a pipeline that looks like this:

TKSM pipeline.

Note how the utilities specified implicitly by the modules that require them. For example, the Tsb module requires the Exprs utility which will be run automatically before the Tsb module by Snakemake. The model variable specifies a sample name that listed in the config.yaml file (check samples section of the config.yaml file). The params variable specifies the commandline parameters that will be passed to the module (see below).

The pipelines can use the MDF output of other pipelines as input too using the Mrg module. Here is an example of that:

TS_experiments:
    TKSM_single_cell_head:
        pipeline:
            - Tsb:
                params: "--molecule-count 1000000"
                model: "N1"
                mode: Xpr_sc
            - Trc:
                params: ""
                model: "N1"
    TKSM_single_cell_p1:
        pipeline:
            - Mrg:
                sources: ["TKSM_single_cell_head",]
            - Flt:
                params: "-c \"info CB\""
            - plA:
                params: "--normal=15,7.5"
            - Tag: 
                params: "--format3 10"
            - SCB: 
                params: ""
            - Tag:
                params: "--format3 AGATCGGAAGAGCGTCGTGTAG"
    TKSM_single_cell_p2:
        pipeline:
            - Mrg:
                sources: ["TKSM_single_cell_head",]
            - Flt:
                params: "-c \"info CB\" --negate"
    TKSM_single_cell:
        pipeline:
            - Mrg:
                sources: ["TKSM_single_cell_p1", "TKSM_single_cell_p2"]
            - PCR:
                params: "--cycles 5 --molecule-count 5000000 -x Taq-setting1"
            - Flp:
                params: "-p 0.5"
            - Tag:
                params: "--format5 AATGTACTTCGTTCAGTTACGTATTGCT --format3 GCAATACGTAACTGAACGAAGT"
            - Seq:
                params: "--skip-qual-compute"
                model: "N1"

This generates the following pipeline: TKSM pipeline

Note how this experiment is actually four different pipelines; each linear segment of the experiment is a pipeline.

Piping

TKSM modules can be piped using Unix pipes in combination with Snakemake. Linear pipelines can be easily pipelined using Snakemake's own pipe() directive. However, for experiments with branching pipelines (more specifically, if a producing step has more than a single consumer), Snakemake raises an error to avoid a possible pipe deadlock condition. To overcome this, if piping is enabled in config.yaml, the Snakefile alters its behaviour by creating a copy of each input/output MDF file that is consumed by more than one step. This duplication is done using our own multithreaded, MDF-specific implementation of cat and tee (py/mdf_cat.py and py/mdf_tee.py). To enable Unix piping when running Snakemake, edit the config.yaml file and set the enable_piping variable to true.

Note that piping can be finicky with some Snakemake commands (e.g. dryrun -n gives an error). You will also need to specify a high enough number of threads, -j, for Snakemake to run all the steps of the pipeline in parallel.

MDF format

A Molecule Description Format (MDF) file is a human-readable file that describes molecules by listing for each molecule the genomic intervals it is composed of alongside custom tags describing sequence-level modifications to these intervals (e.g. substitutions). We’ve designed MDF for TKSM inter-module communication.

Each MDF entry (A molecule description) begins with a header line which consists of + symbol, followed by <molecule_id>, <molecule_count> and <molecule_info>.

+molecule_1 1 info1=1,2,3,4;info2;

This molecule header line is parsed by TKSM to:

{
	"Id": "molecule_1",
	"depth": 1,
	"info": {
		"info1": [1, 2, 3, 4],
		"info2": "."
    }
}

The header line is followed by a variable number of interval lines which are quite similar to the BED format:

chr	start	end	orientation	mods

The fields are tab-separated.

  • The chr field is the name of the contig. Different intervals of the same molecule can be on different contigs.
  • The start and end fields are the start and end positions of the interval (0-based, end-exclusive).
  • The orientation field is the orientation of the interval (+ or -). Different intervals of the same molecule can have different orientations.
  • The <mods> field can be empty but the tab character preceding it is required. The <mods> is a list of comma separated base substitutions (no indels) local to the interval sequence represented in the current line. The substitutions are applied to the interval sequence before the strand is flipped (if the strand is -).

For example, consider the following FASTA contig and MDF entry:

FASTA:

>1 
AGTCCCGTAA

MDF:

+m1 1 
1	0	4	+	2C,3T
1	6	9	+	1G

Given the FASTA and MDF records, we can construct the sequence of the m1 molecule.

  • First we construct the sequence of the first interval: (chr1, 0, 4) = AGTC.
  • We apply the modifications on position 2 and 3: AGTC -> AGCC -> AGCT.
  • Then we construct the second interval: (chr1, 6, 9) = GTA.
  • We apply the modification on position 1: GTA -> GGA.
  • Finally, we concatenate the two intervals to get the sequence of the m1 molecule: AGCTGGA.

If the contig name is not in the provided reference FASTA but is nonetheless a valid nucluic sequence, TKSM will use the contig name as the contig sequence. Consider for example the following FASTA and MDF records:

FASTA:

>1 
AGTC

MDF:

+m1 1 
TT	0	2	+
1	0	4	+

sequencer

>m1
TTAGTC

Modules

TKSM is written in C++ and Python. The main driver is written in C++ and the modules are written in either C++ or Python. All the modules (C++ and Python) are compiled into a single executable. For the Python modules, the Python script is "compiled" into byte array, included as a C++ header file, and is run using Python C++ embedding.

To run a specific module, you need to specify the module name as the first argument to the executable:

tksm <module_name> [module_arguments]

The following arguments are common to all TKSM modules:

Short Long Description
-h --help Prints the help message and exits.
-v --version Prints the version and exits.
-vb --verbosity Sets how much information is printed by the module.
-s --seed Specifies the RNG seed (default is 42).
-l --log-file Specifies where logs are printed (default is stderr).

There are four types of modules: utility modules, entry-point modules, core modules, and the exit module.

Utilities

Utilities generate models that are used by other modules. Thus, they do not generate MDF files. The models they generate are based on an input sample (e.g. modeling the truncation in a specific real sample's reads). In the pipeline config.yaml file, the steps that can use a utility to model a sample take the model parameter. The Snakemake will automatically run the utiltiy to generate the model before running the step that uses the model.

Abundance estimation utility

This utility is used by the Tsb module to generate a transcript abundance model of a given sample. The utility's source code is in py/transcript_abundance.py. To run this utility, use the Exprs module:

tksm abundance [arguments]

The Exprs module has these arguments:

Short Long Description
-p --paf PAF file of the mapping of the long-reads to the reference transcriptome.
-m --lr-br TSV output of the long-reads barcode matching from scTager (e.g. S1.lr_matches.tsv.gz)
-o --output Path for the output file (e.g cDNA.abundance.tsv.tsv.gz or cDNA.abundance.tsv). Will be gzipped if it ends with .gz extenstion.
-em --em-iterations Number of EM iterations to run (default: 10).

The utility uses a modified version of Jared Simpson's Transcript Quantification Python script. The main modification is that we added a single-cell mode to the script. If the --lr-br argument is provided, which specifies the matched cellular barcode of each long-read, the utility will consider each (cellular barcode × transcript) pair as a separate transcript computing the transcript abundance for each pair separately.

The output of this utility is a TSV file with the following columns:

  1. Transcript ID (PAF target name). Transcripts with less than 0.001 TPM abundance are filtered out.
  2. Transcript abundance (TPM)
  3. Cellular barcode (empty for transcripts with no cellular barcode)

Badread utility

This is not really a TKSM utility but rather Badread's own utility. The Snakefile will run badread error_model and badread qscore_model commands to generate the error and quality score models to be used by the Seq module. The Snakefile assumes that the badread executable is in the $PATH. To specify which sample to use to model the error and quality scores, use the model parameter of the Seq module step in the config.yaml file. Note that TKSM is prepackaged with some precomputed error and quality score models. To see the list of installed models run:

tksm sequence --help

KDE utility

This utility is used by the Trc module to generate a 2D KDE truncation model of a given sample. The utility's source code is in py/truncate_kde.py. To run this utility:

tksm model-truncation [arguments]

The KDE module has these arguments:

Short Long Description
-i --input PAF file of the mapping of the long-reads to the reference transcriptome.
-o --output A .json file for the truncation model output
-b --bandwidth Bandwidth value for the KDE. If set to -1, script will use cross validation to compute it.
--grid-start Read/transcript length start of the KDE grid.
--grid-end Read/transcript length end of the KDE grid.
-t --threads Number of threads to run KDE and GridSearchCV.

Entry-point modules

The entry modules are the modules that are used to start a simulation pipeline. They generate MDF files as output. As input, they may take an MDF file (e.g. the output of another pipeline).

Transcribing

The Tsb module is used to generate MDF files from an annotation GTF file and a transcript abundance model. The module's source code is in src/transcribe.cpp. To run this module:

tksm transcribe [arguments]

The Tsb module has these arguments:

Short Long Description
-g --gtf Path to the GTF annotation file.
-a --abundance Path to tab separated abundances tables (formatted as transcript_id\tpm\cell-barcode).
--use-whole-id Do not trim the transcript version.
--molecule-count Number of molecules to simulate.
-o --output Output path.
--non-coding Process non-coding genes/transcripts as well.
--default-depth Default depth for transcripts that are not in expression table (default: 0).
--molecule-prefix Prefix for molecule names (default: M).
-w --weights Comma separated weights of each provided abundance file (default: 1).

Additionally, the Tsb module has a submodule for generating fusion transcripts. The fusion submodule's code is in src/fusion.cpp. The submodule has the following arguments:

Short Long Description
--fusion-gtf Path to output GTF annotation file.
--fusion-file Path to tab separated fusion file.
--fusion-count Number of random fusions to generate (default: 0).
--disable-deletions Disables deletions (from fusions) that removes expression on the overlapping genes.
--translocation-ratio Ratio of translocated fusions (default: 0).
--expression-fallback Fallback expression distribution for transcripts that are not expressed. If not provided only expressed transcripts will be fused. Comma separated list of distribution type and parameters. Available distributions: uniform,s,e; normal,μ,σ.

If the fusion submodule is used, new fusion transcripts will be created The --fusion-file argument is a TSV file with the following columns:

The Tsb outputs an MDF file with a record for each transcript molecule sampled from the GTF file. The cellular barcode for each molecule is added as a comment to the molecule header line: CB=<cellular_barcode>; or CB; if the molecule has no cellular barcode.

Merging

The Mrg module concatenates a list of MDFs into a single MDF. It is phoney module; it is really just a cat Linux command that is run by Snakemake. If the Snakefile is run in a piped mode, then the Mrg module will use the mdf_cat.py script to merge the MDFs.

Core modules

The core modules of TKSM all take an MDF file and ouptut an MDF file. The perform modifications on the molecules, create new molecules, or filter molecules, or alter the order of the molecules in an MDF file. All the core modules have the following arguments:

Short Long Description
-i --input Input MDF file.
-o --output Output MDF file.

Single-cell barcoding

The SCB module is used to add cell barcodes to the molecules. The module's source code is in src/scb.cpp. It looks for the cellular barcode in the molecule header line (CB tag) and adds it to the beginning of the sequence of the molecule. To run this module:

tksm scb [arguments]

It has the following argument:

Short Long Description
--keep-meta-barcodes Keep the barcodes in the mdf metadata

Tagging

The Tag module is used to add tags to the molecules. The module's source code is in src/tag.cpp. These tags can be used to simulate the addition of sequences such as UMIs or adapters. To run this module:

tksm tag [arguments]

The Tag module has these arguments:

Short Long Description
-5 --format5 5' TAG format.
-3 --format3 3' TAG format.

The module adds the tags to the beginning (3') or end (5') of the molecule sequence. The tag format uses the IUPAC nucleic acid notation and randomly picks one of the bases for each molecule for the ambiguous letters.

Filtering

The Flt module is used to filter molecules based on a set of conditions. The module's source code is in src/filter.cpp. To run this module:

tksm filter [arguments]

The Flt module has these arguments:

Short Long Description
-t --true-output Output MDF file for molecules that pass the filter.
-f --false-output Output MDF file for molecules that fail the filter.
-c --condition Comma separated conditions to filter (and-ed together).
--negate Negate the conjunction of the condition(s).

The implemented conditions are:

  • info: Check if a non-empty info tag exists in a molecule.
  • size: Filters molecules w.r.t their size [<, >, <=, >= , ==, !=].
  • locus: is similar to samtools view selection. If any of the molecule's intervals overlaps with the specified location or range, TKSM will consider the condition fulfilled.

Examples:

  • -c "info CB": Checks if a molecule has a non-empty CB comment
  • -c "size >1000","size <=1500": Selects molecules with size (1000,1500]
  • -c "locus chr1": Selects molecules with an interval from chr1
  • -c "locus chr1:1000": Selects molecules that overlap with chr1 position 1000
  • -c "locus chr1:1000-1500": Selects molecules that overlap with chr1 between position 1000 and 1500.
  • -c "locus AGATCGGAAGAGCGTCGTGTAG": Selects molecules with this "contig". While this is not a real contig name, modules such as Tag and SCB add put the sequence of the tag as the contig name (see above)

PCR

The PCR module is used to simulate PCR amplification. The module's source code is in src/pcr.cpp. To run this module:

tksm pcr [arguments]

The PCR module has these arguments:

Short Long Description
--molecule-count Number of molecules to simulate.
--cycles Number of PCR cycles to simulate.
--error-rate Error rate for PCR.
--efficiency PCR efficiency.
-x --preset Presets (see below).

The --preset argument can be used to specify a preset PCR error rate and efficiency as measured by Cha et al (1993). The following presets are available:

  • Klenow: error-rate: 0.000130, efficiency-rate: 0.800000
  • T4: error-rate: 0.000003, efficiency-rate: 0.560000
  • T7: error-rate: 0.000034, efficiency-rate: 0.900000
  • Taq-setting1: error-rate: 0.000200, efficiency-rate: 0.880000
  • Taq-setting2: error-rate: 0.000072, efficiency-rate: 0.360000
  • Vent: error-rate: 0.000045, efficiency-rate: 0.700000

polyA tail

The plA module is used to add polyA tails at the end of molecules. The module's source code is in src/polyA.cpp. To run this module:

tksm polyA [arguments]

The plA module has these arguments:

Short Long Description
--gamma Use Gamma distribution [α,β].
--poisson Use Poisson distribution [λ].
--weibull Use Weibull distribution [α,β].
--normal Use Normal distribution [μ,σ].
--min-length Minimum length of polyA (default: 0).
--max-length Maximum length of polyA (default: 5000).

The format of the distribution parameters is --<distro>=<param1>,<param2>.

Strand flipping

The Flp module is used to flip the strand of molecules according to a random probability. The module's source code is in src/flip.cpp. To run this module:

tksm flip [arguments]

The Flp module has these arguments:

Short Long Description
-p --flip-probability Probability of flipping the strand.

The module will flip the strand (i.e. flip each interval and reverse the order of the intervals) if the coin flip is successful under the given -p probability.

Glueing

The Glu module is used to glue molecules together according to a random probability. The module's source code is in src/unsegment.cpp. This is meant to simulate the behaviour of the Oxford Nanopore sequencer failing to segment the signal of two consecutive molecules it reads. To run this module:

tksm unsegment [arguments]

The Glu module has these arguments:

Short Long Description
-p --probability Probability of gluing the molecule to its successor.

Note: If the coin flip is successful, the module will glue the molecule to its successor and a new coin flip will be made for the next molecule, potentially gluing it to its successor as well.

Shuffling

The Shf module is used to shuffle the order of molecules. The module's source code is in src/shuffle.cpp. To run this module:

tksm shuffle [arguments]

The Shf module has these arguments:

Short Long Description
-b --buffer-size Buffer size for shuffling. If not set, the whole file is read into memory.

If the buffer size is less than the number of molecules in the input MDF file, the module will read buffer_size molecules. Then, it then randomly pops a molecule from the buffer and writes it to the output MDF file. It then replaces the popped molecule with a new molecule from the input MDF file. This process is repeated until the input MDF file is exhausted and then the remaining molecules in the buffer are written to the output MDF file in a random order. This creates a localized shuffling effect for the molecules. The smaller the buffer size relative to the MDF size, the more localized the shuffling effect is.

Truncating

The Trc module is used to truncate the molecules. The module's source code is in src/truncate.cpp. To run this module:

tksm truncate [arguments]

The Trc module has these arguments:

Short Long Description
--kde-model model.json output of the model-truncation
--normal Use Normal distribution [μ,σ].
--lognormal Use Log-Normal distribution [μ,σ].

The KDE model is generated by the KDE utility. If --normal or --lognormal is used, the module will use the specified distribution to sample the truncation length. The format of the distribution parameters is --<distro>=<param1>,<param2>.

Exit module

The exit module is the module that generates the final output of the simulation pipeline by sequencing the molecules of the MDF file it is given.

Sequencing

The Seq module is used to sequence the molecules and is currently the sole exit module of TKSM. The module's source code is in py/sequence.py. To run this module:

tksm sequence [arguments]

The Seq module has these arguments:

Short Long Description
-r --references Reference FASTA files, space separated.
-o --badread Badread reads output file. Default: no output.
--perfect Perfect reads output file. Default: no output.
--skip-qual-compute Use all K for q-scores. Default: compute quality score using Edlib alignment to input sequences.
-O --output-format Output format. Default: infer from output file extension and fallback to FASTA. Accepts .gz files too.
-t --threads Number of threads.
--badread-identity Sequencing identity distribution (mean, max and stdev)
--badread-error-model Badread tail model name or file path. Available model names: [random, pacbio2016, nanopore2018, nanopore2020]
--badread-qscore-model Badread qscore model name or file path. Available model names: [random, ideal, nanopore2018, nanopore2020, pacbio2016]
--badread-tail-model Badread tail model name or file path. Available model names: [no_noise]

The Seq can be asked to generate both --badread and --perfect reads. The --badread reads are generated using a modified, multi-threaded version of Badread simulator. The modified code of Badread is in py/tksm_badread.py. TKSM looks for the Badread models in the directory specified by the $TKSM_MODELS environment variable. If the variable is not set by the user at the time of running TKSM, TKSM will default to the INSTALL_PREFIX variable set during installation (more specifically, $INSTALL_PREFIX/bin/tksm_models/badread). To see where the default models path points to, run:

tksm sequence --help

Cite

If you like and use TKSM, please cite our manuscript:

TKSM: Highly modular, user-customizable, and scalable transcriptomic sequencing long-read simulator. Fatih Karaoglanoglu, Baraa Orabi, Ryan Flannigan, Cedric Chauve and Faraz Hach. Bioinformatics, 2024; DOI: 10.1093/bioinformatics/btae051

Contributing

Wanna contribute? That's great! If you want to add a new module, please check existing modules first and follow the same style. For C++ modules, please use the src/module_template.cpp and src/module_template.hpp files as templates. Then add the module to the src/tksm.cpp file following the same style as the other modules. For Python modules, please use py/transcript_abundance.py as a template. Then add the corresponding C++ source and headers in src following the pattern of src/transcript_abundance.cpp and src/transcript_abundance.h. Finally, add the module to the src/tksm.cpp file following the same style as the abundance module. Note that you do not need to create a header for the Python module in the py_headers directory. Headers there are created by the Makefile automatically using the xxd tool.

To add the module to the Snakefile, you write a new rule for it. Follow the pattern set by the other rules of its type (e.g. filter for core, transcribe for entry-point, and sequence for exit). Use a nice three-letter name for the rule output name (e.g. Tsb for transcript abundance).

If your edits are working as expected, make a PR and we will be happy to merge it. Feel free to contact us if you have any questions by opening an issue or emailing us at borabi at cs.ubc.ca or fatih_karaoglanoglu at sfu.ca.

About

Very modular, very cool long-read transcriptomic simulator

Resources

Stars

9 stars

Watchers

4 watching

Forks

Releases

Packages

Used by

Contributors

Languages